circad | circRNAs associated with diseases
GSDMB ecircRNA/hsa_circ_0106803
 GeneGSDMBOrganismHuman
 Genome Locuschr17:38065210-38066177:-Buildhg19
 DiseaseMultiple SclerosisICD-10 Multiple sclerosis (G35)
 DBLinkLink to databasePMID28272342
 Experimental Method
 Sample TypeBlood samplesComparisonPatients diagnosed with Multiple Sclerosis and age- and sex-matched healthy controls declared no familial history for autoimmune or neurodegenerative diseases.
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GGGGATTCTCACAACTTCCA

Reverse

CTCCTTGTTGGGGAAGACAA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Cardamone, G, Paraboschi, EM, Rimoldi, V, Duga, S, Soldíƒ , G, Asselta, R (2017). The Characterization of GSDMB Splicing and Backsplicing Profiles Identifies Novel Isoforms and a Circular RNA That Are Dysregulated in Multiple Sclerosis. Int J Mol Sci, 18, 3:no page given.