Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
GSDMB ecircRNA/hsa_circ_0106803 | |||
Gene | GSDMB | Organism | Human |
Genome Locus | chr17:38065210-38066177:- | Build | hg19 |
Disease | Multiple Sclerosis | ICD-10 | Multiple sclerosis (G35) |
DBLink | Link to database | PMID | 28272342 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | Patients diagnosed with Multiple Sclerosis and age- and sex-matched healthy controls declared no familial history for autoimmune or neurodegenerative diseases. |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GGGGATTCTCACAACTTCCA ReverseCTCCTTGTTGGGGAAGACAA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Cardamone, G, Paraboschi, EM, Rimoldi, V, Duga, S, Soldí , G, Asselta, R (2017). The Characterization of GSDMB Splicing and Backsplicing Profiles Identifies Novel Isoforms and a Circular RNA That Are Dysregulated in Multiple Sclerosis. Int J Mol Sci, 18, 3:no page given. |